Table One, Wilson

<span style="font-family:Arial; mso-bidi-font-family:"Times New Roman""><o:p></o:p></span></p> <font face="Arial, Helvetica, sans-serif" size="2"><b style="mso-bidi-font-weight:normal">Table 1. A listing of the examples in the text as well as in Wilson et al. (2002). The resulting alignment and coded differences based on the recommendations provided are also shown. Examples 7-9, 12, 17, and 20-22 are discussed in Wilson et al. (2002).<o:p></o:p></b> <br /> <br /> </font> <table border="1" cellspacing="0" cellpadding="0" style="border-collapse:collapse; border:none;mso-border-alt:solid windowtext .5pt;mso-padding-alt:0in 5.4pt 0in 5.4pt"> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt; height:.5in"> <p class="MsoNormal"><b style="mso-bidi-font-weight:normal"><span style="font-family:Arial;mso-bidi-font-family:"Times New Roman""><font face="Arial, Helvetica, sans-serif">Example Number and CRS Positions</font><o:p></o:p></span></b></p> </td> <td width="216" style="width:2.25in;border:solid windowtext .5pt;border-left: none;mso-border-left-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt; height:.5in"> <h1><span style="font-size:10.0pt;font-family:Arial;mso-bidi-font-family: "Times New Roman";text-decoration:none;text-underline:none"><font face="Arial, Helvetica, sans-serif">Example Sequence and CRS</font><o:p></o:p></span></h1> </td> <td width="216" style="width:2.25in;border:solid windowtext .5pt;border-left: none;mso-border-left-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt; height:.5in"> <h1><span style="font-size:10.0pt;font-family:Arial;mso-bidi-font-family: "Times New Roman";text-decoration:none;text-underline:none"><font face="Arial, Helvetica, sans-serif">Recommended Alignment<o:p></o:p></font><o:p></o:p></span></h1> </td> <td width="198" style="width:148.5pt;border:solid windowtext .5pt;border-left: none;mso-border-left-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt; height:.5in"> <h1><span style="font-size:10.0pt;font-family:Arial;mso-bidi-font-family: "Times New Roman";text-decoration:none;text-underline:none"><font face="Arial, Helvetica, sans-serif">Recorded Differences</font><o:p></o:p></span></h1> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;background:#D9D9D9;mso-shading: windowtext;mso-pattern:gray-15 auto;padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><span style="font-family:Courier"><font size="2" face="Courier New, Courier, mono">1<o:p></o:p></font><font size="2"><o:p></o:p></font></span></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">488-504</font></span></font><span style="font-family:Courier"><o:p></o:p></span></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><span style="font-family:Courier"><font size="2" face="Courier New, Courier, mono">ATACAACCCCCACCCAT<o:p><br /> </o:p></font></span><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ATACAACCCCCGCCCAT</font></span></font><font face="Courier New, Courier, mono"><span style="font-family:Courier"><o:p></o:p><o:p></o:p><o:p></o:p></span></font><span style="font-family:Courier"><o:p></o:p></span></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><span style="font-family:Courier"><font face="Courier New, Courier, mono" size="2">ATACAACCCCCACCCAT<o:p><br /> </o:p></font></span><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ATACAACCCCCGCCCAT</font></span></font><font face="Courier New, Courier, mono"><span style="font-family:Courier"><o:p></o:p></span></font><span style="font-family:Courier"><o:p></o:p></span></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><span style="font-family:Courier"><font size="2" face="Courier New, Courier, mono">499A<o:p></o:p><o:p></o:p></font><font size="3" face="Courier New, Courier, mono"><o:p></o:p></font><font face="Courier New, Courier, mono"><o:p></o:p><o:p></o:p></font><font face="Verdana, Arial, Helvetica, sans-serif"><o:p></o:p></font><font face="Arial, Helvetica, sans-serif"><o:p></o:p></font><font face="Georgia, Times New Roman, Times, serif"><o:p></o:p></font><font face="Times New Roman, Times, serif"><o:p></o:p></font><o:p></o:p></span></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt; height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">2<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">488-504</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ATACAACCCCACCCAT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ATACAACCCCCGCCCAT<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ATACAACCCC-ACCCAT<o:p><br /> </o:p></font></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ATACAACCCCCGCCCAT</font></span></font><font size="2" face="Courier New, Courier, mono"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">498D, 499A</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;background:#D9D9D9;mso-shading: windowtext;mso-pattern:gray-15 auto;padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">3</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">244-253</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ATTGATGTC</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ATTGAATGTC<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ATTGA-TGTC</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ATTGAATGTC</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">249D</font></span></font><font size="2" face="Courier New, Courier, mono"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt; height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">4<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">280-294<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">CATAACAAAATTT<o:p></o:p></font><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">CATAACAAAAAATTT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">CATAACAAAA--TTT<o:p></o:p></font><o:p></o:p><br /> </span></font><font size="2"><span style="font-family:Courier"><o:p></o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">CATAACAAAAAATTT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">290D, 291D</font></span></font><font size="2" face="Courier New, Courier, mono"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;background:#D9D9D9;mso-shading: windowtext;mso-pattern:gray-15 auto;padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">5<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">508-529<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ACCCAGCACACACACACACCGCTG<o:p></o:p></font><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ACCCAGCACACACACACCGCTG<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ACCCAGCACACACACACACCGCTG<o:p></o:p></font><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ACCCAGCACACACACAC--CGCTG</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">524.1A, 524.2C</font></span></font><font size="2" face="Courier New, Courier, mono"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt; height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">6<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">508-529<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ACCCAGCACACACCGCTGC</font></span></font><font size="2" face="Courier New, Courier, mono"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ACCCAGCACACACACACCGCTGC<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ACCCAGCACACAC----CGCTGC</font></span></font><font size="2" face="Courier New, Courier, mono"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ACCCAGCACACACACACCGCTGC <o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">521D, 522D, 523D, 524D</font></span></font><font size="2" face="Courier New, Courier, mono"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;background:#D9D9D9;mso-shading: windowtext;mso-pattern:gray-15 auto;padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">7<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">508-529<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ACCCAACACACACACCGC<br /> </font></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ACCCAGCACACACACACCGC<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ACCCA--ACACACACACCGC</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ACCCAGCACACACACACCGC<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">513D, 514D</font></span></font><font size="2" face="Courier New, Courier, mono"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt; height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">8<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">508-529<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ACCCAGTACACACACCG</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ACCCAGCACACACACACCG<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ACCCAGTACACACAC--CG</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">ACCCAGCACACACACACCG</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">514T, 523D, 524D</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;background:#D9D9D9;mso-shading: windowtext;mso-pattern:gray-15 auto;padding:0in 5.4pt 0in 5.4pt;height:.5in" height="25"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">9<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16180-16198<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in" height="25"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCCCCTCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAAACCCCCTCCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in" height="25"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCCCCTCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAAACCCCCTC-CCCATGCT<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in" height="25"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16183C, 16189C, 16190.1T</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt; height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">10<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16180-16198<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoFooter" style="tab-stops:.5in"><font size="2"><span style="font-size:10.0pt; font-family:Courier"><font face="Courier New, Courier, mono">AACCCCCCCCCCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-size:10.0pt; font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-size:10.0pt; font-family:Courier"><font face="Courier New, Courier, mono">AAAACCCCCTCCCCATGCT<o:p></o:p><o:p></o:p><o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoFooter" style="tab-stops:.5in"><font size="2"><span style="font-size:10.0pt; font-family:Courier"><font face="Courier New, Courier, mono">AACCCCCCCCCCCCATGCT<o:p></o:p></font><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAAACCCCCTCCCCATGCT<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16182C, 16183C, 16189C</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;background:#D9D9D9;mso-shading: windowtext;mso-pattern:gray-15 auto;padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">11<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16180-16198<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCCCCCCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-size:10.0pt; font-family:Courier;mso-fareast-font-family:"Times New Roman""><font face="Courier New, Courier, mono">AAAACCCCCTCCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-size:10.0pt; font-family:Courier;mso-fareast-font-family:"Times New Roman""><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCCCCCCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAAACCCCCTCCCC-ATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16183C, 16189C, 16193.1C</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt; height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">12<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16178-16198<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">TTAACCCCCTCCCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">TCAAAACCCCCTCCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">TTAA--CCCCCTCCCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">TCAAAACCCCCTCCCC-ATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16179T, 16182D, 16183D, 16193.1C</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;background:#D9D9D9;mso-shading: windowtext;mso-pattern:gray-15 auto;padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">13<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16180-16198<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAAACCTCCCCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAAACCCCCTCCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAAACCTCC-CCCCATGCT<br /> </font></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAAACCCCCTCCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16186T, 16189D</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt; height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">14<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16176-16198<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCCCTCCCCCATGT</font></span></font><font size="2" face="Courier New, Courier, mono"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAAACCCCCTCCCCATGT<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">CATCAAACCCCCCCTCCCCCATGCT<br /> </font></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">CATCAAAACCCCC-TCCCC-ATGCT<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16183C, 16188.1C, 16193.1C<o:p></o:p></font><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;background:#D9D9D9;mso-shading: windowtext;mso-pattern:gray-15 auto;padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">15<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16178-16198<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">TTAAACCCCCCCCTCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">TCAAAACCCCCTCCCCATGCT<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">TTAAACCCCCCCCTCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">TCAAAACCCCCTC-CCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16179T, 16183C, 16189C, 16190.1T<o:p></o:p></font><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt; height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16180-16198<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCTCCCCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAAACCCCCTCCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAA-CCCCCTCCCCCCATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAAACCCCCTCCCC--ATGCT</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">16183D, 16193.1C, 16193.2C</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;background:#D9D9D9;mso-shading: windowtext;mso-pattern:gray-15 auto;padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">17<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">300-317<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCCCCCGC<o:p></o:p></font><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCCCTCCCCCGC<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCCC----CCGC<o:p></o:p></font><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCCCTCCCCCGC</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">310D, 311D, 312D, 313D</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt; height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">18<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">300-317<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCCTCCCCCCGC<o:p></o:p></font><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCCCTCCCCCGC</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCC-TCCCCCCGC<o:p></o:p></font><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCCCTCCCCC-GC</font></span></font><font size="2" face="Courier New, Courier, mono"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">309D, 315.1C</font></span></font><font size="2" face="Courier New, Courier, mono"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;background:#D9D9D9;mso-shading: windowtext;mso-pattern:gray-15 auto;padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">19<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">300-317<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCCCTTCCCCCCGC</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCCCTCCCCCGC<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCCCTTCCCCCCGC</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAACCCCCCCT-CCCCC-GC</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">310.1T, 315.1C</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt; height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">20<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">461-476<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAAGACACCCCCCCCC<o:p></o:p></font><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAAGACACCCCCCACA<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAAGACACCCCCCCCCCCCACA<o:p></o:p></font><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AAAGACACCCCCC------ACA<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">573.1–573.6C<o:p></o:p></font><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;background:#D9D9D9;mso-shading: windowtext;mso-pattern:gray-15 auto;padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">21<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">98-114<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">CTGGAGCACCC<o:p></o:p></font><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">CTGGAGCCGGAGCACCC</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">CTGGAGC------ACCC</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">CTGGAGCCGGAGCACCC</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; background:#D9D9D9;mso-shading:windowtext;mso-pattern:gray-15 auto; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">105-110D<o:p></o:p></font><o:p></o:p></span></font></p> </td> </tr> <tr style="height:.5in"> <td width="127" style="width:95.4pt;border:solid windowtext .5pt;border-top: none;mso-border-top-alt:solid windowtext .5pt;padding:0in 5.4pt 0in 5.4pt; height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">22<o:p></o:p></font><o:p></o:p></span></font></p> <p class="MsoHeader" style="tab-stops:.5in"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">93-114<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AGATCCTGGAGCCCCC<o:p></o:p></font><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AGACGCTGGAGCCGGAGCACCC<o:p></o:p></font><font face="Courier New, Courier, mono"><o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="216" style="width:2.25in;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AGATC-CTGGAGCC------CCC</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"><o:p><br /> </o:p></span></font><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">AGA-CGCTGGAGCCGGAGCACCC<o:p></o:p></font><o:p></o:p></span></font></p> </td> <td width="198" style="width:148.5pt;border-top:none;border-left:none; border-bottom:solid windowtext .5pt;border-right:solid windowtext .5pt; mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt; padding:0in 5.4pt 0in 5.4pt;height:.5in"> <p class="MsoNormal"><font size="2"><span style="font-family:Courier"><font face="Courier New, Courier, mono">95.1T, 97D,</font></span></font><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier"> <o:p></o:p></span></font></p> <p class="MsoNormal"><font face="Courier New, Courier, mono" size="2"><span style="font-family:Courier">106-111D<o:p></o:p></span></font></p> </td> </tr> </table> <p class="MsoBodyTextIndent2" style="margin-top:6.0pt;text-indent:0in;line-height: normal"><b style="mso-bidi-font-weight:normal"><o:p></o:p></b><o:p></o:p></p> <p class="MsoBodyTextIndent2" style="margin-top:6.0pt;text-indent:0in;line-height: normal"><o:p><font face="Arial, Helvetica, sans-serif" size="2"><a href="">Back to article</a></font></o:p></p>