Table One, Wilson

Table 1. A listing of the examples in the text as well as in Wilson et al. (2002). The resulting alignment and coded differences based on the recommendations provided are also shown. Examples 7-9, 12, 17, and 20-22 are discussed in Wilson et al. (2002).

Example Number and CRS Positions

Example Sequence and CRS

Recommended Alignment

Recorded Differences

1

488-504

ATACAACCCCCACCCAT
ATACAACCCCCGCCCAT

ATACAACCCCCACCCAT
ATACAACCCCCGCCCAT

499A

2

488-504

ATACAACCCCACCCAT
ATACAACCCCCGCCCAT

ATACAACCCC-ACCCAT
ATACAACCCCCGCCCAT

498D, 499A

3

244-253

ATTGATGTC
ATTGAATGTC

ATTGA-TGTC
ATTGAATGTC

249D

4

280-294

CATAACAAAATTT
CATAACAAAAAATTT

CATAACAAAA--TTT
CATAACAAAAAATTT

290D, 291D

5

508-529

ACCCAGCACACACACACACCGCTG
ACCCAGCACACACACACCGCTG

ACCCAGCACACACACACACCGCTG
ACCCAGCACACACACAC--CGCTG

524.1A, 524.2C

6

508-529

ACCCAGCACACACCGCTGC
ACCCAGCACACACACACCGCTGC

ACCCAGCACACAC----CGCTGC
ACCCAGCACACACACACCGCTGC

521D, 522D, 523D, 524D

7

508-529

ACCCAACACACACACCGC
ACCCAGCACACACACACCGC

ACCCA--ACACACACACCGC
ACCCAGCACACACACACCGC

513D, 514D

8

508-529

ACCCAGTACACACACCG
ACCCAGCACACACACACCG

ACCCAGTACACACAC--CG
ACCCAGCACACACACACCG

514T, 523D, 524D

9

16180-16198

AAACCCCCCCCTCCCATGCT
AAAACCCCCTCCCCATGCT

AAACCCCCCCCTCCCATGCT
AAAACCCCCTC-CCCATGCT

16183C, 16189C, 16190.1T

10

16180-16198

AACCCCCCCCCCCCATGCT
AAAACCCCCTCCCCATGCT

AACCCCCCCCCCCCATGCT
AAAACCCCCTCCCCATGCT

16182C, 16183C, 16189C

11

16180-16198

AAACCCCCCCCCCCCATGCT
AAAACCCCCTCCCCATGCT

AAACCCCCCCCCCCCATGCT
AAAACCCCCTCCCC-ATGCT

16183C, 16189C, 16193.1C

12

16178-16198

TTAACCCCCTCCCCCATGCT
TCAAAACCCCCTCCCCATGCT

TTAA--CCCCCTCCCCCATGCT
TCAAAACCCCCTCCCC-ATGCT

16179T, 16182D, 16183D, 16193.1C

13

16180-16198

AAAACCTCCCCCCATGCT
AAAACCCCCTCCCCATGCT

AAAACCTCC-CCCCATGCT
AAAACCCCCTCCCCATGCT

16186T, 16189D

14

16176-16198

AAACCCCCCCTCCCCCATGT
AAAACCCCCTCCCCATGT

CATCAAACCCCCCCTCCCCCATGCT
CATCAAAACCCCC-TCCCC-ATGCT

16183C, 16188.1C, 16193.1C

15

16178-16198

TTAAACCCCCCCCTCCCATGCT
TCAAAACCCCCTCCCCATGCT

TTAAACCCCCCCCTCCCATGCT
TCAAAACCCCCTC-CCCATGCT

16179T, 16183C, 16189C, 16190.1T

16

16180-16198

AAACCCCCTCCCCCCATGCT
AAAACCCCCTCCCCATGCT

AAA-CCCCCTCCCCCCATGCT
AAAACCCCCTCCCC--ATGCT

16183D, 16193.1C, 16193.2C

17

300-317

AAACCCCCCCCCGC
AAACCCCCCCTCCCCCGC

AAACCCCCCC----CCGC
AAACCCCCCCTCCCCCGC

310D, 311D, 312D, 313D

18

300-317

AAACCCCCCTCCCCCCGC
AAACCCCCCCTCCCCCGC

AAACCCCCC-TCCCCCCGC
AAACCCCCCCTCCCCC-GC

309D, 315.1C

19

300-317

AAACCCCCCCTTCCCCCCGC
AAACCCCCCCTCCCCCGC

AAACCCCCCCTTCCCCCCGC
AAACCCCCCCT-CCCCC-GC

310.1T, 315.1C

20

461-476

AAAGACACCCCCCCCC
AAAGACACCCCCCACA

AAAGACACCCCCCCCCCCCACA
AAAGACACCCCCC------ACA

573.1–573.6C

21

98-114

CTGGAGCACCC
CTGGAGCCGGAGCACCC

CTGGAGC------ACCC
CTGGAGCCGGAGCACCC

105-110D

22

93-114

AGATCCTGGAGCCCCC
AGACGCTGGAGCCGGAGCACCC

AGATC-CTGGAGCC------CCC
AGA-CGCTGGAGCCGGAGCACCC

95.1T, 97D,

106-111D

Back to article