Population Data on the STR Loci D7S820, D8S1179, and D12S391 in a Sample Population of Rio de Janeiro, Brazil, Forensic Science Communication, January 2003
![]() |
![]() |
January 2003 - Volume 5 - Number 1 |
Research and Technology
Population Data on the STR Loci D7S820, D8S1179, and D12S391 in a Sample Population of Rio de Janeiro, Brazil
Giselle G. Gomes
Graduate Student
Laboratorio de Metabolismo Macromolecular Firmino Torres de Castro
Instituto de Biofísica Carlos Chagas Filho
Sylvia M. Marsillac
Undergraduate Student
Laboratorio de Metabolismo Macromolecular Firmino Torres de Castro
Instituto de Biofísica Carlos Chagas Filho
Rodrigo S. Moura-Neto
Associate Professor
Departamento de Genetica
Instituto de Biologica
Rosane Silva
Associate Professor
Laboratorio de Metabolismo Macromolecular Firmino Torres de Castro
Instituto de Biofísica Carlos Chagas Filho
Universidade Federal do Rio de Janeiro
Rio de Janeiro, Brazil
Abstract | Introduction | Materials and Methods | Results and Discussion
References
Allelic distribution for three tetrameric short tandem repeat (STR) loci, D7S820, D8S1179, and D12S391, were determined in a Rio de Janeiro, Brazil, sample population. There were no detectable departures from Hardy-Weinberg expectations in any of the three loci, and there was little evidence for associations of alleles between loci in the database. Departures from expectation of independence were observed at D8S1179/D12S391 (p=0,0488).
Brazil was colonized by the Portuguese at the beginning of the 16th century. Until the end of the 19th century, an official government population survey indicated that the people were miscegeneous: 44 percent Caucasians, 14.6 percent African descendants, and 41.4 percent mulattos (IBGE 2000). After that, other ethnogeographic populations migrated to Brazil from Europe, mainly Spain, Italy, and Germany, and from Japan. Due to highly ethnical miscegenation, it is difficult to identify and study the genetic composition of any given group. Using restricted fragment length polymorphorism genotyping of nine variable number tandem repeat loci, previous work (Moura-Neto and Budowle 1997; Silva and Moura-Neto 1998) had shown no detectable population substructure in a Rio de Janeiro sample population, when compared to United States ethnic groups. Recently, using Y-chromosome single-nucleotide polymorphism haplotyping, it has been demonstrated that the majority of the paternal lineages of Brazilian population descendants originated from Europe (Carvalho-Silva et al. 2001). Also, Y-chromosome STR haplotyping of a Rio de Janeiro sample population has shown a haplotype primarily found in the Europeanlike profile (Costa et al. 2002). Rio de Janeiro is the most representative site of the “melting pot” of Brazilian culture. The aim of this work is to introduce new data about three commonly used STRs in a sample population of Rio de Janeiro, Brazil, that can be used in match probabilities calculations, substructure population analysis, and genetic distance.
Samples and DNA Extraction
DNA samples were extracted from peripheral blood samples from 97 unrelated individuals from Rio de Janeiro’s population. The considered population structure for Rio de Janeiro is comprised of European-derived Brazilians. African-derived and native Brazilian descendants have been excluded. For this study DNA was extracted according to Miller et al. (1988).
PCR Amplification
PCR amplification for the loci D7S820 (GenBank: G08616), D8S1179 (GenBank: G08710), and D12S391 (GenBank: G08921) was carried out as described with minor modifications.
- Initial denaturation of 5 minutes at 92ºC
- 27 cycles of 30 seconds at 94ºC
- 75 seconds at 55ºC
- 15 seconds at 72ºC
- Final extension step of 6 minutes at 72ºC
In a volume of 25 ml, 200mM of dNTPs; 50ng of genomic DNA; 1,5U of Taq DNA polymerase; 10 mM Tris-HCl pH 8.3; 1,5mM of MgCl2 ; 50 mM KCl and 1uM of the primers as listed.
- D8S1179, F: 5’TTTTTGTATTTCATGTGT ACATTCG3’,
R: 5’CGTAGCTATAATTAGTTCATTTTCA3’ - D7S820, F: 5’TGTCATAGTTTAGAACGAACTAACG3’,
R: 5’CTGAG GTATCAAAAACTCAGAGG3’ - D12S391, F: 5’CCAGAGAGAAAGAATCAACA3’,
R:5’TGCCTT TTAGACCTGGACTG3’
STR Typing and Sequencing
Different allele sizes were determined through the analysis of PCR product on 6 percent denaturing polyacrylamide gel electrophoresis and visualized with silver nitrate staining. Alleles under homozygous suspicion, after the amplification, were sequenced by dideoxy termination using the Big Dye Terminator Cycle Sequence in an ABI Prismâ3100 Genetic Analyzer with separation medium POP-6ä(Applied Biosystems, Foster City, California).
Statistical Analysis
Frequency of alleles, Hardy-Weinberg equilibrium, and other population parameters were calculated using Genetic Data Analysis Software V1 - d16 (Lewis and Zaykin 2001).
Ninety-seven unrelated individuals were genotyped for the loci D7S820, D8S1179, and D12S391. Alleles already described for these loci were found in the Rio de Janeiro sample population. In order to confirm the genotyping, direct sequencing of amplified products was performed and compared with the standard alleles obtained for K562 cell lineage.
The frequency distributions of the observed alleles are shown in Table 1. Different numbers of alleles were found.
- locus D7S820, 8 alleles
- locus D8S1179, 11 alleles
- locus D12S391, 11 alleles
The observed and expected homozygosities test to evaluate the occurrence of Hardy-Weinberg expectations, the discrimination power, the fixation index, and the probability of exclusion are also provided in Table 1. All three loci are highly polymorphic in the Rio de Janeiro sample population. No detectable departures from Hardy-Weinberg expectations were observed.
An interclass correlation test analysis was performed to detect any correlation between alleles at any of the pairwise comparisons of the three STR loci. The only departure from observed expectations was for the D8S1179/D12S391 comparison (p=0,0488), whereas the other two pairwise comparisons showed no detectable deviations: D7S820/D8S1179 (p=0,1160) and D7S820/D12S391 (p=0,4268). However, after the Bonferroni correction (Weir 1996), this observation is not significant.
Genotype data for this study is available at the following e-mail address: rsmneto@biologia.ufrj.br
In conclusion, the Rio de Janeiro database has been established for the loci D7S820, D8S1179, and D12S391. The results of independent testing support the use of these data for estimating the matching probability of a DNA profile containing these three STR loci.
Carvalho-Silva, D. R., Santos, F. R., Rocha, J., and Pena, S. D. J. The phylogeography of Brazilian Y-chromosome lineages, American Journal of Human Genetics (2001) 68: 281-286.
Costa, A. N., Silva, R., and Moura-Neto, R. S. Y-chromosome variation in a Rio de Janeiro, Brazil, population sample, Forensic Science International (2002) 126:926-928.
IBGE - Instituto Brasileiro de Geografia Estatística. Brasil: 500 anos de povoamento, IBGE, Rio de Janeiro, 2000.
Lewis, P. O. and Zaykin, D. Genetic data analysis: Computer program for the analysis of allelic data. Version 1.0 (d16). 2001. Available: http://alleyn.eeb.uconn.edu/gda
Moura-Neto, R. S. and Budowle, B. Fixed bin population data for the VNTR loci D1S7, D2S44, D4S139, D5S110, D10S28 and D14S13 in a population sample from Rio de Janeiro, Brazil, Journal of Forensic Sciences (1997) 42:926-928.
Miller, S. A., Dykes, D. D., and Polesky, H. F. A simple salting-out procedure for extracting DNA from human nucleated cells, Nucleic Acids Research (1988) 16:1215.
Silva, R. and Moura-Neto, R. S. Allelic frequency distribution for three VNTR markers, D6S132, D7S467, D17S26, in Rio de Janeiro population, Brazil, Forensic Science International (1998) 94:33-38.
Weir, B. S. Genetic Data Analysis II. Sinauer Associates, Sunderland, Massachusetts, 1996.






